An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT107327.1

General info


NONCODE TRANSCRIPT IDNONMMUT107327.1
NONCODE Gene IDNONMMUG023450.2
Chromosomechr2
Start Site74695600
End Site74697365
Strand+
Exon Number2
CNCI Score-0.0507904
Length462
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT107327.1
TGGCTGGCCTCCATTGCAGGAACAAGCAACAGCTTAGCAGGGCACTGGATCCAATTGTGCCCCCCCAAGTCCCTTTCTCTTTCCCACCCGCCCCAAGCTCAAGACAACCAGACCCAGTGAAGCCAAGGGCCATTCCAGAAGGCTGGGGAAAGATGAGGCACCATGGCCATCACTGTCGGCTCCTTGGGACTCCAGTGCTCACCACCCATGCGAGGGCAGAGAGACAGCCCTTGGAGGCCGCCCCTTGGAAGCCATGCTGAGCTGGACCAGGCCCGAGAGTCCAGTTGACCCAGCTCACCCCCTGGGCCTCGGGGCGTGTGCCTAGCTTTTTGTCGAGGGTTTACATGTGGCTGCCCCGGGAGTGTGAGCGCGGTAGAGGGAGGGGCACTCCGAGCTGCTCCATCCGTCCGTTTTATTAGGGACACATTAATCTATAATCAAATACACCTCATAAAATTTTTA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT037976.2

Data Sources

Source NameOld Id
gencodeENSMUST00000152027.2
ensemblENSMUST00000152027