An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT107328.1

General info


NONCODE TRANSCRIPT IDNONMMUT107328.1
NONCODE Gene IDNONMMUG023455.2
Chromosomechr2
Start Site74752684
End Site74753745
Strand+
Exon Number2
CNCI Score-0.0548864
Length895
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT107328.1
TTCTCTGTGCCACGCAGGAAAGTGGGTCACAGGAGGATTGCTCTGGGGAGTTGGTCCCCGTGTCCCTCACTCCTGTCTGCCATTCCTTAGAGTAGAGCCGACGCCATCCCAGGCTGGCAGAACACAAAGGAAACCCCTATTCGGTCCCCGGACCTTAGGGTCACTGTAAGCAGGAGGCTGGTGTGTTTTCCAGTCTCAGAACTCCGGCCGCCCGCGGGAACAATAGCGGCCGCCTGCCCGGGAGGTCGGACGCTCGGCACAAAGCCGGCTTGGTCCGCGCGGCCGGCCACACGACGCGCGCTGACCCGGCTGCCGTCGCTCGCCGGTGTTCCCGCGTCCACCTGGAACTCTTCGAGAAAGACAAACGGGGTTCCTCCTACTTTAGAGCAAGTCTGGGCCAGCTGGGAGCCGACCAGAAACCGCAAGCGAAGGAGACGCGGGCGCTCCGGGTGAGCGCTGAGGGAGGGGGCGACACACAGTCCTGCGGCTGCCCAGGATAGCGCTCCAGGCACGCAGGAGGGGAAGGTCGGTGGACATCTCTGTGCGGCACCGAAGGGAGGGCCACTGCTTACTTCTCAGCTCTAACCGCAGCCCTCCAGCACGGACCTCGAACTTCATAGCAAATCTACACCCACGCTGTCCCCCGACCCATTGTGACCCGGCATTCTCCCTCCTATCCCAGTGACACTCACACAAGCCGCTCTATTTCTAGAAAGGGAAACTCTTTCTGAAGGCAGGGCAAGAACAGTCCCAATGAATCAAGGTTTCTTATTGACCCCAAGTCTGCCTGCAGGCCTCTCTGCGTGGGAGTAAGTAGGTCAAAGCGGCCACTGAACTTGGAGTAAACTTGAATTCCCTTTAAAGTTACAATAAAAGTATGTATATATTCATCACA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT107329.1
NONMMUT037992.2
NONMMUT037993.2

Data Sources

Source NameOld Id
PMID24463510ENSMUSG00000085015_dup1