An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT107377.1

General info


NONCODE TRANSCRIPT IDNONMMUT107377.1
NONCODE Gene IDNONMMUG067128.1
Chromosomechr2
Start Site76814680
End Site76880265
Strand+
Exon Number3
CNCI Score-0.0122880
Length476
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT107377.1
GTCCTTCATCCAGGTTGTAATGGCAGTGGATGGGGAGACCAAACATTCGAAGATGGCAGAAGAGCCCACAGACTCTGCCTCTGTCAAAACGATGTCTTTGATTTCTTTCACGAATTTCAGTGGCACGGCCTTGATGAAATTGATGGGAGACATAGGAAGCACCAACACTCATGAGCTAGGACCATCAAAGCCACAGAAGTGCAAGAAATGAATGAGCAGCTGTCTTTGCCGACAGGGTTTTGCACTTCAAAGCTGTACACCCCACTGTCGCCAGGCACCACATTGATGATCTTGAGGCCAGACACCTTGTTGAAGAAGCTTATTTTATATTTGTTGTCACTCGTGAGCTCCTTTCCGTCCTTAAACCACTTGGTACTAAGCTCAGGTGTTCCTGATACCGTGCACTCCAAGGTACAGGTGTCTCCTGTGGTCACCTTAATAGATTCTGGCTTTTCCACAATTGCAGCAGGCTCTGA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
00001.40780
Loading...

Isoforms

Transcript ID
NONMMUT107376.1

Data Sources

Source NameOld Id
PMID24463510blastnHuman.ENSG000002344