An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT113011.1

General info


NONCODE TRANSCRIPT IDNONMMUT113011.1
NONCODE Gene IDNONMMUG070848.1
Chromosomechr3
Start Site30793137
End Site30793560
Strand-
Exon Number1
CNCI Score-0.1056768
Length423
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT113011.1
CACCACAGAGCCCTCGGCCGAGCGGCCGCTAACACCGTCCCGCCTCGAGACCATCCCGGCGCCGCGACCCCGCGGAGACGGCCTCCGGGCGTCCGGCCGCTCGGGACGTCTCCCCCTGTCCCTCCTCGTCCCAGCGCGCCCGAGCCCGTCCCCGGTCCCACGGCCCCGCCGAGCTACCTGGATCCGCTTCTTGTGTCGCCTGCGTTCCGCCATGTTGGCCGCTCCGCCCGGTTCCTTCTGACGTGGAGCGAGTCGGGGAGGGGGCGGCTGAGATCTCGCGAGAGCGCGGCGGCTCGCGGCCCGTTATGTAACCCGCCGCGGGCTCTGGGCTGGGGGCGGCCTCCGTGGTCTTCCCGCCGTCCGTGCGGTGGCGGACGACGCGGGCTGCTTCTGCTTCTGGTCCCGGAGGCCGGCGCCACGTGA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
01.66673000.6879341.07636
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
gencodeENSMUST00000187361.2
ensemblENSMUST00000187361