An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT117875.1

General info


NONCODE TRANSCRIPT IDNONMMUT117875.1
NONCODE Gene IDNONMMUG031630.2
Chromosomechr4
Start Site156052715
End Site156059803
Strand-
Exon Number2
CNCI Score-0.0004096
Length1536
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT117875.1
GCCGAGAGCAGTTTCTTTCCTCCTCATTGTCCCCGAGTTGTCGACCTGTGCCAGTTCACTGTGCACCTTAGTGTTCTTTGTGTTTGAGGCTCACCTGGAGGGGAGACAGTCATTCTTTCCTGTGACGCCCCAGCTACAACGCCTGAGTCTGAGTCCTGGCTGAGGGAAAGTTTGGGTTGATGCCAGAGCTGGTCGCCCAGCCCTATCCACCACTGCTGACAGGTATCAAATCCAACTGCCCAGATGGGGAGGCCCTTGTACTGCCCTGCTGATGGATGTCTTACCAGACATGGTTAGATCTGGATGCATCTGTCTAATACTGTCTGGTAATGCCGTCCATCCACGGCCTTATCACCGCTGGAGACGACATCCTCACCACCTCGTGGACACTGGGTAGAGACAAGACCTTAATCCATCTGTTACAACTGTCCAGAGCTGGGTTCATCAAGCCCTCTATGCAAACAGACCACAGTTTAAATATACAGGCCCCGCTGAGCCTGACTGCCTTCCTCTGACCCTGTAGTAGCTTTCGGTTACAGCCACAGCAGACTGAGGCCTCCGTATCCATCCTTTTCAGGAATAGTCAGTGGGGCGGTCACAGTCCTCTTGCCCTCCATAGCCCACTGGGCTCCACACAGAGACTTCGATCTGTCGTCAGCTGTCACCTGCAGATTCTGTAGCCCCTGTGCTATCAACACTGGTAGGAGACAAGAGGAGATCTAAAACCTTGGTCCTTTGTCTCCTCTCCAAAATTCTCAGGTCATGGAACCAAGGAGAGTAAAAGCAAGTCTAACCACTGTGCCCAAACCCGGAGTGGAAAATAAGTATATGGGTTTCAGGGACAGGGGCACTGCCAAGGTGCCAGACCAGGTGATAGTGACTCATACCCAGGAATATGCACAAGGCTGCACAGCTCTGCCGTTGTCAGCCTGCTTATGAGCTCTTCCTATGCATCCCACCTCTGGCTCTTAGGATCTGAGAGTCATCTTTCAGTCTAACTCTGGATGCTGAATGGCCCGATCTTAAAGATCCCACCCCCACCCCATGTCCCTGAGAATTTTCAAAAGGCTGTTGCTAAAACGGTTGCTCTAGAATGACTCCCAATGCTTACATCATTTGCTATATGGGGAGTTTGAGTGTTGCTGTGATAAGAACTAGAAGTGAACCTCTTAGACCTCATCTGCAAGCTGCTGGCTTCAGTACCTAGACTTCTGCAAACCTCAAGTTGGCCAATACAGCCTGAGTCCAGCAGAGCCAAACCCTACCTCATCCACTGCCCTCTTGAAGGAACCCAACATGCCCTAACAGATTTCTTAGCCCTGGACAGGCCATTCCTCTAAAGAACCATTATAGGGACACTGGACTTCATCTTCCACAGAAACCTGCTGGGCTCCAAGTTCTATGTGGCTGAGGGACTTGTCCGCCCATCGTGCGCTCTATAATAGGTGGTCCCCTTTTTGTCATCTCTTCAAGCATTGTAAATAAAATGCAGGCAAAAAAAATCTTTGTAAGGCAATAAATTGTGTGATTTCTGAA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
00.1008090.26690.2458010.01591450
Loading...

Isoforms

Transcript ID
NONMMUT051047.2

Data Sources

Source NameOld Id
PMID24463510ENSMUSG00000086549