An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT118799.1

General info


NONCODE TRANSCRIPT IDNONMMUT118799.1
NONCODE Gene IDNONMMUG033049.2
Chromosomechr5
Start Site97644161
End Site97645436
Strand+
Exon Number1
CNCI Score-0.0081920
Length1275
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT118799.1
ATAGGTGTTGGCTTCAGTCACTTTAGGACATACATTCTGGAGGGGCATTAGGAACAAATACACAGATACTAACTTTCTGCAACAAAATGGAATGCTTTAAAATCATTGCCTAGCAAATTGATCTTCCCTTTTTAAAGTGGTTGTGTTTCAGGAGGTGTGAATGTTTAAGTAATGATAAAACATTTTCAATAAGGTGAGGAAGAATGTTGGTTACTTGGTGAATGTAAACAGAACTGAATGAGGAAGCTCTGGATAAATACATTTCCAATAACGATTTATTTACATGAATTTCTATTCAGGAAGCAAAGTTTAAATCCCGAATCATATAAACTATTCCCTATATTCAGAAAATATAGGAAGCAACTTGAAGCTCATTTTATTCATTTCTTGAAAAAGGATTTTTGAAATACAGGTATACCTGGCCACAGGAAATCCAGACACATGCAAAATCAGATTTACACATAGGATAAATTATTTTAAGGGTTCTCTGAACACCAATGGCTTCATCCATCAACTTGAAGCTGCTTCTGCAAATGTGCACACACTTCCTGAAAAGATTTATAATCCAGCCAATACGGTACATTTTGAATGTGTTACAGAAAGGACAGATTTACAGGAGACAATCTGCCTTCATGACGATTGCATATTGTGGCATTTCTAGTCCATATGGATCAGTAAGAGTTGGATAGCAGGCATTTGACCTTCAAAATCATGCAAATGTGAAACCAGACTTCTCCTCTTACAGCTGCAAGCGTCAGTAGGACTTCTTCAGCTTCTTCTGGGGGAACTGATTAAAACACAGTTTGACTACAGAGGCGTCCTGAGGTTTGACTACTCCTGTGCTTCTCCTCAGAGAGAAAGGTCTCCCTCTTTGCTCCCTTCCCACACATCCCCTCTGGCTAACCTTCGCTCATTAGCACCCAAATCTCAGCTACTGATCATTTAAGAGAGAACTTGCTAACTCCTAGCCACAGGCTAGCTCTGAACAAGACATCAACCCTTTTTGTTCCCGTCACAGTTAATCTCCAGGAATAAGTTCTGATAGCCTTTGAAAAGGTCTGAACGTAGTTTTCTGTCACAGGCCCTTGGAAGCTATGCTTTCTCACTTCCAAACCTTGATAGTGCCAGAGAGAATCAGACTGTTTATCTAGCAATGATAATTTTCTGGGTTTATAGTGTAACAATTCGCCAAGATTATTGGAACAGAATCACAAGAAGTTATATTTGTTAATCGGCCAACTTTTTTTTTTCCATTTAAAAATTCATTGCAAAATG

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
000.0015137100.008448820
Loading...


Isoforms


Transcript ID
NONMMUT053203.2
NONMMUT053204.2
NONMMUT053205.2
NONMMUT053206.2
NONMMUT053207.2
NONMMUT053208.2
NONMMUT118795.1
NONMMUT118796.1
NONMMUT118798.1
NONMMUT118800.1

Data Sources


Source NameOld Id
PMID24038472CUFF.56618.1