An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT120626.1

General info


NONCODE TRANSCRIPT IDNONMMUT120626.1
NONCODE Gene IDNONMMUG075661.1
Chromosomechr5
Start Site67221957
End Site67231725
Strand-
Exon Number4
CNCI Score-0.0630784
Length883
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT120626.1
CTCATCATGTATAAAATGGTGCAGTAGGATGCAAAATTTCCACTTGTTTATAAGTGTATCGGGGAGAAATGTATAAAATAATCGAGAGCGGCGGAGGCAGGTCAGAGCCGTCTGGAGTACTCGCACCTCCAACGCAGACAAAAGTGCTGGAACCTTCTTCTCCGTCCCCACCCCCAGCGCCCGCTGCCCAGGCGGGTGAGCTCGACCCCCGCCGCGACCCCTCGCGGAGCCCGACCCGCGCGATTACTAAGGAGACGCGGCCTCTGGGCTGCTGGCCCTGCGCCGTTTGAAAACGGATCCATCAGCGGCCTTTTGTTTGTGTGTGAGGGATACGGATTGTGGCAGCAGCCGAGCAAAAGGGGGAAATTAATTGCAGCCAATTAATAATTAATCCCCCTTAAACAGCTTTATTATCTCTCTCGAACGACAGGGATTTGTCTGATAACCCCCCGAAGACCAAATGTCAAGTTTAACCAAATAGTTATTGCTTTATCAACCCGAGTCTGCAAATAAATTAATCAAAAGCAAAGGAACAATGCCAACATTGAAGCCCTCGGTTGGAGTCTGCACAGTTGGAGATCTTTGGTGCCGTTTTTTTAGACATCTTTGGATTTCATCAATCAAACTGACTGCAATTTTCCATAAAAACCCTGAATTTGGGTCAGAAAGTGGGCAAAGTAGATAAAGATCATTCGAGCTGTCTTATAAGATGATAAATAGTTATCCTTTCAGGCCAACAATGCTAAAGTGCAGTTTTGTGATTCCCTTCCATGGGTTGTGAATGCAGTGAGTCGAAACGATTTATACATGTTTTCCCATGGTTTAGGGGGTGTCTTTACATACTTGTCAATAGTAGTCTGACCTTTCCCCCATGGAGTGGCTA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000000
Loading...

Isoforms

Transcript ID
NONMMUT120625.1

Data Sources

Source NameOld Id
PMID24463510blastnHuman.ENSG000002458