An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT121609.1

General info


NONCODE TRANSCRIPT IDNONMMUT121609.1
NONCODE Gene IDNONMMUG076259.1
Chromosomechr5
Start Site143418086
End Site143419695
Strand-
Exon Number2
CNCI Score-0.1126400
Length275
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT121609.1
TACCTTTTGTAATGTACAAGTAGAAGAAGTCGCAGTAGAGAATGGTCTGGACGACACCAGCCACCACAGCAATGAGATCAAAGAAGCCCTCGAAGTAGAAGCGCCAGATCCAGTTGACCAGGTACAGAGCGCGGTAGAGGCCCAGGAAGAAACCTCAAGAGGAGAGAAGTCATGATTGACTAGAAATGAGAGGCCTCCTACAGGAACCACCAGGAACTCCACTCGGAAGGTATCGTGATTTCCATCATAGGTGGCCTTAAATTTCATGTAGATCA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
3020.89543.014373.3251291.42288.841882.125
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510blastnXenopus.LocusForwar