An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT122273.1

General info


NONCODE TRANSCRIPT IDNONMMUT122273.1
NONCODE Gene IDNONMMUG076689.1
Chromosomechr6
Start Site52169938
End Site52170741
Strand+
Exon Number3
CNCI Score-0.0786432
Length247
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT122273.1
ATCACAGGTGGGTGAGCTTGGGCGCTTCCTGAATTCTTCCCTGAGAAGGATGGTGGGCAGTAAGGTCCGTGTAGGTGGGGTGTGGCTCCTCATGGGCTCCACATAGCTGCCCCCTACGAAGACGGGGCTTCCCTGTATGAAGTGGAACTCCTTCTCCAGCTCTACCAGCTGCGCGCTCGTGTACGCCGTGCGCGCGCGCTTGGACGAGGCCTGCCCAGGCGGGCTCTTGTCACCAGCGCAGCTCTCC

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
00005.372580
Loading...


Data Sources


Source NameOld Id
PMID24463510blastnOpossum.LocusRevers