An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT122274.1

General info


NONCODE TRANSCRIPT IDNONMMUT122274.1
NONCODE Gene IDNONMMUG035350.2
Chromosomechr6
Start Site52172881
End Site52174060
Strand+
Exon Number2
CNCI Score-0.0716800
Length552
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT122274.1
GCAGCACGACGTGGCCCCGGGCGCAGGGAGCCGCACTATAAAAAGCTGCTGGAATTTACTGGCAGCTACAAATATTTGCTTAACTTGCGTCTGGAGTTGGGGGATTTTCCGCGGAGCAGCAGAACCAGCAATTTGAAACAAGCCACTCCAACCTCTTTTTCAAAGTTATAGGAGGTTCCCTGTCTTGAAGTCTCCTGCCTTGGATTTTCTGAGGTGCTGCTATTCTGGGCAACTATCAAAATCCTACCTGTTAAAACATGATGGATTAGAGAAAAAAAACAACCCACCAGGAACCTGAAAAACCGGCGTTCATCTCCATGACCACGGCTTGAACTCTCCTTCCAACTTAACGATAATAGGTTCTGTCTTAGAAACTGCTATGTAATTTGATGTATGGGGGTCATTTGGCTCCAGAGGAGGCATGGAAGCACAAACCATAAACTCCTGCCAGACTTCCCTGATCTTTGTATACTTTTGTTGGTCATATTTGTTATTTGGTCCATTTTCCTGCTTCAGAAATACTAAGTAAAGAAAAACATCTTTTTAAAAAAC

Expression Profile(Data Source:ERP000591)


hearthippocampusliverlungspleenthymus
00000.2213860.0784095
Loading...


Isoforms


Transcript ID
NONMMUT056945.2

Data Sources


Source NameOld Id
PMID24463510ENSMUSG00000087626_dup1