An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONMMUT123153.1

General info


NONCODE TRANSCRIPT IDNONMMUT123153.1
NONCODE Gene IDNONMMUG077243.1
Chromosomechr6
Start Site135772227
End Site135785813
Strand+
Exon Number2
CNCI Score-0.0147456
Length339
Assemblymm10
Other transcript VersionsNone

Sequence


>NONMMUT123153.1
ACTCCTCTTGGATCATGAAGGCGGCTAAGTTGGCAGTGTAGCTGGCCAGGAAAATGACAGCAAAGAAGGCCCACACTGACACCATGATCTTGGAGGTGGTCCCCTTTGGGTTCTGCACAGGAGAGACTTGTGGAAACACTCCAAATGGGACTGACTGGTTGAAAGCGAAGTGAAGGGAGTAACCAGGCACGCTTGCCTCCAGAGAACGGAAGCCTTGTCTGGGAGCCTGGAAAGACGGGAGTGTGTAAACCTGATGATGTGGATAAGAAAGGAGGTGAACTGGAACTATCTCAGAGAAAACCCGAAGCAGAAAACTGAACAAAGTGTTCATAGTCAGGA

Expression Profile(Data Source:ERP000591)

hearthippocampusliverlungspleenthymus
000007.12487
Loading...

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510LocusForward_85377