An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONPPYT015590.1

General info


NONCODE TRANSCRIPT IDNONPPYT015590.1
NONCODE Gene IDNONPPYG013421.1
ChromosomechrX
Start Site134007707
End Site134008563
Strand-
Exon Number2
CNCI Score-0.1081344
Length359
AssemblyponAbe2
Other transcript VersionsNone

Sequence


>NONPPYT015590.1
ACAGCTTCGCAGGCAAATCCCAGAAACCTTTGCAAAAAGCTTGCAATGAAATTTAAGAAGTTCTTCGATTTCGGCGCCATTTTCGAGTGGAGCCAGAGGTGAGTGTTTGGGGTGTGGGGGACGAAGGCATATGCAAAATTAAAAGACAAAACGTTGTAGAGTATGAACAGAGGAAGAGGCGTATTCTTTGGCTCTTAAATCATTTAGCCAAACACATTGCAGTTCAGAAGGGGGTGGGGCTATGGCAACTCGAAAGTATCGATTCTTTGTCTATTGTATCAGGAATGACCCTCTCCTGAAGTGACAAGACGCCCCTTTGTAATCTCTTTTCGTAAGTAAATTTCAGTCTAAGGGGAAAT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24463510H19X