An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONRATT021947.2

General info


NONCODE TRANSCRIPT IDNONRATT021947.2
NONCODE Gene IDNONRATG017911.2
Chromosomechr4
Start Site176281849
End Site176282130
Strand-
Exon Number1
CNCI Score-0.1515520
Length281
Assemblyrn6
Other transcript VersionsNONRATT021947.1(old version)

Sequence


>NONRATT021947.2
GATATGAATATGAAACAACGATTTTACCTACAAGCAACTTGTCCTCAAACAGCTTCTTGTGTATGGAGAACCAAACCCAGACCTTAAATCCAGCGCAAGACCCAGCAGGTTGACTCCTGCTTCTCATTGCTTTCAGCTCAGAGACTCAGACACAGAATGTTCTTTTATGAAGGGTTTTAATACGACACTGGGTTTAGTAGACATGTGAGACAAATGAACACAATTTATTTCCCTCTTCATGGAAGGGATATGTTAATAACCTAGACTACTCTTCCTCCTGA

Isoforms

Transcript ID
NONRATT021944.2
NONRATT021946.2

Data Sources

Source NameOld Id
PMID24510058Slc21a4.fSep08