An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONRATT027254.2

General info


NONCODE TRANSCRIPT IDNONRATT027254.2
NONCODE Gene IDNONRATG022180.2
Chromosomechr7
Start Site132078789
End Site132089637
Strand-
Exon Number4
CNCI Score-0.0110592
Length525
Assemblyrn6
Other transcript VersionsNONRATT027254.1(old version)

Sequence


>NONRATT027254.2
GGACAGCTAGGGACTTGCGTGTGTTCAGCGTTTAGTCTGCCTTGTGACAGGCACTTTAAGAACTTCAGGACTAAGTCTGTGGCCTGGAATCTCCATGCAGTTCCAGGCAGCCATCTGTATCAGAAAAAAAAGTACCAGAGCCTTCCCCTGTAACAAGGAGAAAGGCATATGAGAAAGCAGACAAAGCAAAGACCAAGGAGCAGAAACAGGGCATTATCAACCCATTTCCTGCCTGCAGAGGAATCAGAGCGTCTTTCCTTCAGTGTGTTCACGTAGCTGAGGGGCACACGAAAGCTGTGCTCTGCGTGGATTCGACTGATGACCTTCTCTTCACTGGATCAAAAGATCGTACTTGTAAAGTTTGGAATCTCGTGACTGGACAGGAAATTATGTCATTAGGGGTTCACCCTAACAACGTTGTGTCTGTAAAATACTGTAATTACACCAGTCTAGTCTTCACAGTGTCAACATCTTATATTAAGGTGTGGGATATCAGAGAGTCAGCGAAGTGCATTCGAACATTAA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24510058Kif21a.eSep08