An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONSUST001156.1

General info


NONCODE TRANSCRIPT IDNONSUST001156.1
NONCODE Gene IDNONSUSG000583.1
Chromosomechr1
Start Site223959086
End Site223960226
Strand+
Exon Number2
CNCI Score-0.0114688
Length964
AssemblysusScr3
Other transcript VersionsNone

Sequence


>NONSUST001156.1
AGACACTCACTGTGAAGACAAACCAGAGAGGGGCAAATGGATTTCAAGGAAGATCTAGGAGCGGAATGTGGAACTCTTAGTTTACTTTTCAGGATTTTCTGGAGAAAAGCGGCATGTGAAGAAATCAACGAACGACCCCAGATGCGGCGAGTTTTACACAGAAAATGCTGGAGCAGAGTAGGAGGCGGCGGTAATATGCGTTCGGGTGAGAGGAAAAGTCACGTGCAAAACTGCTACTTACTGGAAACCTGGAGACTCGCGTCCAGCTCCACCGGAGAGTGACTGGGAAGAGAGGATCCTGGAACTTCGAATTTGCCCACTTATTCTTAAGTTTCCATGGTCGAGGTGGTGCTAAACAGCTCTCCAGAGAACTGTTTGCTGTTTTTCAATCCTGGTGAAATTCCTGTGCTTTCCAGAGGTCCGCGCGCAGACTGAAGTGGATTGTAGCGAGAGCAACTGTTGACAGACTGTTAACTGCAAAGATTTGTTTTATCTATATAGGATAGGATACAGAAAGCCGCCTGTGAATTACCACTTGAAAAGATTTCATGATATTTTGTAAATTGTTCTTCAGTAACAGTTTTACCTAATATTTAAGACTTACTTAAGACTTTAAATAACAAAGTAACTTGTGGCCCTGTGGGAAAGAGGGGAGGACGAACTACAGCTTTTATATGAAGATATGTCACAGTGCCAACGCCCAGATTACTTTCATCCTTAACCTATTTATTTCTTTGTTAAATTTTCTCTTTCCTTTACTAGAGTATCTCAGTATAAAAGAAATATGAAACATTACAAACGTATTTTAGAAAATCGATGCACTTACCCTGTAAATTATCTTGCGATATTTCCAAAGAGTTGCTGAAAGAGTAAATTGAATATAAAACTGTTGAAAAAAGATGATGGTTCATTGAATATCATAATATTTGCTGGAAAAACTAAAGGCACACTGTTTGGAAATTTA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
CAUTCONS_00003105