Bioinformatics Research Group, CAS
HOME Keyword Search Browse DB Specific ncRNA Statistics Blast Help DownloadGenome (NEW)
Welcome to NONCODE -- the database of all kinds of noncoding RNA !
uniq-ncRNA u5
Browse ncRNA
Browse uniq-ncRNA
Browse nucleotide
Browse traditional class
Browse pfclass
Browse specific ncRNA
Browse taxonomic tree
 
 
Search in NONCODE :
Google
This site is powered by :
Revised: Jun 28, 2007.
detailed information on uniq-ncRNA u5
Go to: General  Description  Sequence 
General Information
uniqid: u5
derived from: n5, n2219, n2234
Description
class: snoRNA
pfclass: RNA_modification_methylation, RNA_modification_methylation, RNA_modification_methylation
length: 88
organism: Arabidopsis thaliana (thale cress)
taxonomic group: thaliana Arabidopsis Brassicaceae Brassicales eurosids II rosids core eudicots eudicotyledons Magnoliophyta Spermatophyta Tracheophyta Embryophyta Streptophyta Viridiplantae Eukaryota
specific feature:
Sequence
1GGCCGGTGATGTAATCAAAATATTTGCTACTCTTGATGAAGAATTTCTTCAGTTGATGAT
61ATTTACCACCAAGATCTCTGAGGCCTTT


All rights Reserved © Copyright 2007.
Any Problem Please Contact: lcn@ict.ac.cn